| Basic information from miRBase |
| hairpin accession number: MI0015921 |
| Located between position 114394216 and 114394284 on chromosome 15 strand + |
| Overlapping with antisense strand of (intron 11). |
| (Ensemble: ENSSSCT00000017661) |
| mature miRNAs for MI0015921: |
| ssc-miR-4334-5p (MIMAT0017966): CCCTGGAGTGACGGGGGTG |
| ssc-miR-4334-3p (MIMAT0020366): TCCCTGTCCTCCAGGAGCTC |
| You can find this miRNA in ENTREZGENE: MIR4334 (accession: 100526405) |
| References |
| [1]Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R, BMC Genomics. 11:275(2010)., "Deciphering the porcine intestinal microRNA transcriptome" |
| [2]Li G, Li Y, Li X, Ning X, Li M, Yang G, J Cell Biochem. 112:1318-1328(2011)., "MicroRNA identity and abundance in developing swine adipose tissue as determined by solexa sequencing" |