| Basic information from miRBase |
| hairpin accession number: MI0015930 |
| Located between position 26389442 and 26389529 on chromosome 9 strand + |
| Overlapping with sense strand of (exon 1). |
| (Ensemble: ENSSSCT00000019820) |
| mature miRNAs for MI0015930: |
| ssc-miR-4336 (MIMAT0017975): CAACTCTGTGGTTTCCTTTACTCATAG |
| You can find this miRNA in ENTREZGENE: MIR4336 (accession: 100526394) |
| References |
| [1]Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R, BMC Genomics. 11:275(2010)., "Deciphering the porcine intestinal microRNA transcriptome" |