miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0013126

Located between position 98703325 and 98703404 on chromosome 4 strand -

Overlapping with sense strand of (exon 1).

(Ensemble: ENSSSCT00000021609)

mature miRNAs for MI0013126:

ssc-miR-92b-5p (MIMAT0017377): AGGGACGGGACGCGGTGCAGTGTT

ssc-miR-92b-3p (MIMAT0013909): TATTGCACTCGTCCCGGCCTCC

You can find this miRNA in ENTREZGENE: MIR92B (accession: 100498724)

References

[1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"

[2]Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R, BMC Genomics. 11:275(2010)., "Deciphering the porcine intestinal microRNA transcriptome"

[3]Li G, Li Y, Li X, Ning X, Li M, Yang G, J Cell Biochem. 112:1318-1328(2011)., "MicroRNA identity and abundance in developing swine adipose tissue as determined by solexa sequencing"