| Basic information from miRBase |
| hairpin accession number: MI0007077 |
| Located between position 39533216 and 39533285 on chromosome 6 strand + |
| mature miRNAs for MI0007077: |
| ssc-miR-99b (MIMAT0006018): CACCCGTAGAACCGACCTTGCG |
| You can find this miRNA in ENTREZGENE: MIR99B (accession: 100316570) |
| References |
| [1]Podolska A, Cirera S, Unpublished., |
| [2]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" |