miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006180
Located between position 863 and 1002 on chromosome TA66345_4565 strand +
mature miRNAs for MI0006180:
         tae-miR1118 (MIMAT0005353): CACTACATTATGGAATGGAGGGA

References
[1]Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q, Genome Biol. 8:R96(2007)., "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)"