| Basic information from miRBase |
| hairpin accession number: MI0008921 |
| Located between position 16168954 and 16169024 on chromosome LG9 strand - |
| mature miRNAs for MI0008921: |
| tca-miR-275-5p (MIMAT0019123): CGTGTTACCTCAGTACCTAGGCTGG |
| tca-miR-275-3p (MIMAT0008379): TCAGGTACCTGAAGTAGCGCGCG |
| You can find this miRNA in ENTREZGENE: Mir275 (accession: 100314353) |
| References |
| [1]Singh J, Nagaraju J, Insect Mol Biol. 17:427-436(2008)., "In silico prediction and characterization of microRNAs from red flour beetle (Tribolium castaneum)" |
| [2]Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S, Genome Biol Evol. 2:686-696(2010)., "Functional shifts in insect microRNA evolution" |