| Basic information from miRBase |
| hairpin accession number: MI0008930 |
| Located between position 17787946 and 17788022 on chromosome LG7 strand - |
| mature miRNAs for MI0008930: |
| tca-miR-317-5p (MIMAT0019130): TGGGGACCACCCTGTGTT |
| tca-miR-317-3p (MIMAT0008390): TGAACACAGCTGGTGGTATCTCAGT |
| You can find this miRNA in ENTREZGENE: Mir317 (accession: 100314374) |
| References |
| [1]Singh J, Nagaraju J, Insect Mol Biol. 17:427-436(2008)., "In silico prediction and characterization of microRNAs from red flour beetle (Tribolium castaneum)" |
| [2]Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S, Genome Biol Evol. 2:686-696(2010)., "Functional shifts in insect microRNA evolution" |