miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008933
Located between position 9783811 and 9783891 on chromosome LG2 strand -
mature miRNAs for MI0008933:
         tca-miR-iab-4-5p (MIMAT0008393): ACGTATACTGAATGTATCCTGA
         tca-miR-iab-4-3p (MIMAT0008394): CGGTATACCTTCAGTATACGTAAC
You can find this miRNA in ENTREZGENE: Miriab-4 (accession: 100314390)

References
[1]Shippy TD, Ronshaugen M, Cande J, He J, Beeman RW, Levine M, Brown SJ, Denell RE, Dev Genes Evol. 218:127-139(2008)., "Analysis of the Tribolium homeotic complex: insights into mechanisms constraining insect Hox clusters"
[2]Singh J, Nagaraju J, Insect Mol Biol. 17:427-436(2008)., "In silico prediction and characterization of microRNAs from red flour beetle (Tribolium castaneum)"
[3]Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S, Genome Biol Evol. 2:686-696(2010)., "Functional shifts in insect microRNA evolution"