miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013721
Located between position 532984 and 533075 on chromosome 26 strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018629)
mature miRNAs for MI0013721:
         tgu-let-7e (MIMAT0014518): TGAGGTAGTAGATTGAATAGTT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"