miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013740
Located between position 6512028 and 6512119 on chromosome 12 strand -
Overlapping with sense strand of XP_002191840.1 (intron 1).
(Ensemble: ENSTGUT00000006336)
mature miRNAs for MI0013740:
         tgu-let-7g (MIMAT0014528): TGAGGTAGTAGTTTGTACAGTT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"