miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013781
Located between position 10493672 and 10493743 on chromosome 20 strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018445)
mature miRNAs for MI0013781:
         tgu-miR-1 (MIMAT0014562): TGGAATGTAAAGAAGTATGTAT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"