miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013708
Located between position 3146829 and 3146939 on chromosome 24 strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018735)
mature miRNAs for MI0013708:
         tgu-miR-100 (MIMAT0014511): AACCCGTAGATCCGAACTTGT
         tgu-miR-100* (MIMAT0014633): ACAAGCTTGTATCTATAGGTCTG

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"