miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013709
Located between position 3149999 and 3150109 on chromosome 24 strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018801)
mature miRNAs for MI0013709:
         tgu-miR-100 (MIMAT0014511): AACCCGTAGATCCGAACTTGT
         tgu-miR-100* (MIMAT0014633): ACAAGCTTGTATCTATAGGTCTG

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"