| Basic information from miRBase |
| hairpin accession number: MI0013731 |
| Located between position 14805606 and 14805718 on chromosome 13 strand - |
| Overlapping with sense strand of XP_002189997.1 (intron 4). |
| (Ensemble: ENSTGUT00000001569) |
| mature miRNAs for MI0013731: |
| tgu-miR-103 (MIMAT0014523): AGCAGCATTGTACAGGGCTATGA |
| References |
| [1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird" |