miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013732
Located between position 68894825 and 68894897 on chromosome 4 strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018741)
mature miRNAs for MI0013732:
         tgu-miR-103 (MIMAT0014523): AGCAGCATTGTACAGGGCTATGA

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"