| Basic information from miRBase |
| hairpin accession number: MI0013733 |
| Located between position 37745864 and 37745976 on chromosome Un strand + |
| mature miRNAs for MI0013733: |
| tgu-miR-103 (MIMAT0014523): AGCAGCATTGTACAGGGCTATGA |
| References |
| [1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird" |