miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013805
Located between position 8487921 and 8488052 on chromosome 15 strand +
mature miRNAs for MI0013805:
         tgu-miR-130b* (MIMAT0014646): CCTCTTTCCCTGTTGCACTACT
         tgu-miR-130b (MIMAT0014578): CAGTGCAATAATGAAAGGGCGT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"