miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013795
Located between position 108161719 and 108161789 on chromosome 2 strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018351)
mature miRNAs for MI0013795:
         tgu-miR-133 (MIMAT0014571): TTTGGTCCCCTTCAACCAGCT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"