miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013796
Located between position 110618925 and 110618995 on chromosome 3 strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018564)
mature miRNAs for MI0013796:
         tgu-miR-133 (MIMAT0014571): TTTGGTCCCCTTCAACCAGCT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"