miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013797
Located between position 10480781 and 10480851 on chromosome 20 strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018494)
mature miRNAs for MI0013797:
         tgu-miR-133 (MIMAT0014571): TTTGGTCCCCTTCAACCAGCT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"