miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013689
Located between position 113641295 and 113641379 on chromosome 1 strand -
mature miRNAs for MI0013689:
         tgu-miR-139 (MIMAT0014500): TCTACAGTGCATGTGTCTCCAGT
         tgu-miR-139* (MIMAT0014626): TGGAGATGCGGCCCTGTTGGAAT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"