miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013824
Located between position 7265533 and 7265602 on chromosome 19 strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018434)
mature miRNAs for MI0013824:
         tgu-miR-144* (MIMAT0014650): GGATATCATCGTATACTGTAAGT
         tgu-miR-144 (MIMAT0014596): TACAGTATAGATGATGTACT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"