miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013652
Located between position 69209753 and 69209868 on chromosome 4 strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018418)
mature miRNAs for MI0013652:
         tgu-miR-146a* (MIMAT0014622): TGAGAACTGAATTCCATGGACT
         tgu-miR-146a (MIMAT0014465): AGTCCATGGTATTCAGTTCTCT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"