| Basic information from miRBase |
| hairpin accession number: MI0013768 |
| Located between position 9797628 and 9797699 on chromosome 2 strand - |
| Overlapping with sense strand of (exon 1). |
| (Ensemble: ENSTGUT00000018248) |
| mature miRNAs for MI0013768: |
| tgu-miR-153 (MIMAT0014552): TTGCATAGTCACAAAAGTGATC |
| References |
| [1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird" |