miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013842
Located between position 112588974 and 112589044 on chromosome 1 strand +
mature miRNAs for MI0013842:
         tgu-miR-155 (MIMAT0014612): TTAATGCTAATCGTGATAGGG
         tgu-miR-155* (MIMAT0014656): CTCCTACACGTTAGCATTAACA

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"