| Basic information from miRBase |
| hairpin accession number: MI0013850 |
| Located between position 7177772 and 7177853 on chromosome 4A strand + |
| mature miRNAs for MI0013850: |
| tgu-miR-15c (MIMAT0014619): TAGCAGCACATCATGGTTTGT |
| References |
| [1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird" |