miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013761
Located between position 10712187 and 10712259 on chromosome 17 strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018528)
mature miRNAs for MI0013761:
         tgu-miR-181a (MIMAT0014546): AACATTCAACGCTGTCGGTGAGT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"