miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013720
Located between position 7274224 and 7274296 on chromosome 4A strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018368)
mature miRNAs for MI0013720:
         tgu-miR-19b (MIMAT0014517): TGTGCAAATCCATGCAAAACTGA

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"