| Basic information from miRBase |
| hairpin accession number: MI0013793 |
| Located between position 1366327 and 1366418 on chromosome 28 strand - |
| mature miRNAs for MI0013793: |
| tgu-miR-204 (MIMAT0014570): TTCCCTTTGTCATCCTATGCCT |
| References |
| [1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird" |