| Basic information from miRBase |
| hairpin accession number: MI0013789 |
| Located between position 5454954 and 5455025 on chromosome 17 strand + |
| Overlapping with sense strand of (exon 1). |
| (Ensemble: ENSTGUT00000018761) |
| mature miRNAs for MI0013789: |
| tgu-miR-219 (MIMAT0014568): TGATTGTCCAAACGCAATTCTT |
| References |
| [1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird" |