miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013714
Located between position 1817289 and 1817362 on chromosome Un strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018265)
mature miRNAs for MI0013714:
         tgu-miR-222 (MIMAT0014514): AGCTACATCTGGCTACTGGGTCTC

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"