miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013827
Located between position 6644931 and 6645001 on chromosome 4A strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018370)
mature miRNAs for MI0013827:
         tgu-miR-223 (MIMAT0014599): TGTCAGTTTGTCAAATACCCC

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"