miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013718
Located between position 100873856 and 100873927 on chromosome Un strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018260)
mature miRNAs for MI0013718:
         tgu-miR-26 (MIMAT0014516): TTCAAGTAATCCAGGATAGGCT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"