| Basic information from miRBase |
| hairpin accession number: MI0013823 |
| Located between position 8783990 and 8784062 on chromosome 19 strand - |
| Overlapping with sense strand of (exon 1). |
| (Ensemble: ENSTGUT00000018605) |
| mature miRNAs for MI0013823: |
| tgu-miR-301-5p (MIMAT0017391): GCTCTGACTTTATTGCACTACT |
| tgu-miR-301 (MIMAT0014595): CAGTGCAATAGTATTGTCAAAGC |
| References |
| [1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird" |