| Basic information from miRBase |
| hairpin accession number: MI0013845 |
| Located between position 32186011 and 32186119 on chromosome Z strand + |
| mature miRNAs for MI0013845: |
| tgu-miR-31 (MIMAT0014615): AGGCAAGATGTTGGCATAGCTG |
| References |
| [1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird" |