miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013752
Located between position 48937654 and 48937723 on chromosome 1A strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018804)
mature miRNAs for MI0013752:
         tgu-miR-33 (MIMAT0014538): GTGCATTGTAGTTGCATTGC

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"