miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013756
Located between position 14972005 and 14972076 on chromosome 14 strand -
Overlapping with sense strand of (intron 7).
(Ensemble: ENSTGUT00000009086)
mature miRNAs for MI0013756:
         tgu-miR-338-5p (MIMAT0017389): AACACTATCCTGATGCTGTCA
         tgu-miR-338-3p (MIMAT0014542): TCCAGCATCAGTGATTTTGTTG

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"