miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0015939
Located between position 1752711 and 1752787 on chromosome 24 strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018667)
mature miRNAs for MI0015939:
         tgu-miR-34c (MIMAT0016928): AGGCAGTGTAGTTAGCTGATTGT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"