miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0015969
Located between position 76202851 and 76202927 on chromosome Un strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018790)
mature miRNAs for MI0015969:
         tgu-miR-34c (MIMAT0016928): AGGCAGTGTAGTTAGCTGATTGT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"