| Basic information from miRBase |
| hairpin accession number: MI0013690 |
| Located between position 7274550 and 7274638 on chromosome 4A strand + |
| mature miRNAs for MI0013690: |
| tgu-miR-363 (MIMAT0014501): AATTGCACGGTATCCATCTGT |
| References |
| [1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird" |