miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013798
Located between position 10362273 and 10362344 on chromosome 7 strand -
Overlapping with sense strand of XP_002192308.1 (intron 4).
(Ensemble: ENSTGUT00000005904)
mature miRNAs for MI0013798:
         tgu-miR-375 (MIMAT0014572): TTTGTTCGTTCGGCTCGCGTTA

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"