miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013657
Located between position 12254268 and 12254356 on chromosome 12 strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018433)
mature miRNAs for MI0013657:
         tgu-miR-425-5p (MIMAT0014470): AATGACACGATCACTCCCGCTG
         tgu-miR-425-3p (MIMAT0014471): CATCGGGGATGTCGTGTCTTT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"