miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013807
Located between position 8486784 and 8486856 on chromosome 15 strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018330)
mature miRNAs for MI0013807:
         tgu-miR-454 (MIMAT0014580): TAGTGCAATATTGCTTATAGGGT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"