miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013840
Located between position 5173177 and 5173247 on chromosome 17 strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018731)
mature miRNAs for MI0013840:
         tgu-miR-455* (MIMAT0014655): TATGTGCCCTTGGACTACATCG
         tgu-miR-455 (MIMAT0014610): TGCAGTCCATGGGCATATACA

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"