| Basic information from miRBase |
| hairpin accession number: MI0013849 |
| Located between position 25436279 and 25436376 on chromosome 2 strand - |
| mature miRNAs for MI0013849: |
| tgu-miR-489 (MIMAT0014618): GTGACATCATATGTACGGCTGC |
| References |
| [1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird" |