miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013763
Located between position 87366743 and 87366835 on chromosome Un strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018266)
mature miRNAs for MI0013763:
         tgu-miR-490 (MIMAT0014548): CAACCTGGAGGACTCCATGCTGT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"