miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013764
Located between position 58337862 and 58337954 on chromosome 1A strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018530)
mature miRNAs for MI0013764:
         tgu-miR-490 (MIMAT0014548): CAACCTGGAGGACTCCATGCTGT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"