miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013800
Located between position 43202366 and 43202437 on chromosome 1 strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018665)
mature miRNAs for MI0013800:
         tgu-miR-92 (MIMAT0014574): TATTGCACTTGTCCCGGCCTGT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"