miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013734
Located between position 109661967 and 109662037 on chromosome 1 strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018365)
mature miRNAs for MI0013734:
         tgu-miR-99 (MIMAT0014524): AACCCGTAGATCCGATCTTGT
         tgu-miR-99* (MIMAT0014635): CAAGCTCGCTTCTATGGGTCT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"