miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013735
Located between position 52861469 and 52861539 on chromosome Un strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018749)
mature miRNAs for MI0013735:
         tgu-miR-99 (MIMAT0014524): AACCCGTAGATCCGATCTTGT
         tgu-miR-99* (MIMAT0014635): CAAGCTCGCTTCTATGGGTCT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"